thE fucK genE
fucK Gene
Genbank name: fucK
EcoGene name: fucK
Divergent gene:
Species with an ortholog: AA EC HI PA ST YP
EcoGene link: EG10350
--------------------------------------------------------------------------------
Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 6.92
Model logo: fucK.1.model.LGO.gif
Sequence logo: fucK.1.LGO.gif
Sequence Alignment: fucK.1.ALGN
Solution location in genomic coordinates: 2935404-2935425
Solution sequence with flanking nucleotides: tgatg CCCGGTCGCTCCGGCTACCGGG cctga
Number of overlapping basepairs with reported site: 0
Site type:
--------------------------------------------------------------------------------
Species that contributed to the solution: EC ST
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 6.10
Model logo: fucK.2.model.LGO.gif
Sequence logo: fucK.2.LGO.gif
Sequence Alignment: fucK.2.ALGN
Solution location in genomic coordinates: 2935443-2935458
Solution sequence with flanking nucleotides: agagt GGTTAGCCGGATAAGC a
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: REPt204 Overlap: 11
--------------------------------------------------------------------------------
Species that contributed to the solution: AA EC
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 1.72
Model logo: fucK.3.model.LGO.gif
Sequence logo: fucK.3.LGO.gif
Sequence Alignment: fucK.3.ALGN
Solution location in genomic coordinates: 2935384-2935403
Solution sequence with flanking nucleotides: taata CATTACTCCCTGATGTGATG cccgg
Number of overlapping basepairs with reported site: 0
Site type:
fucK Gene
Genbank name: fucK
EcoGene name: fucK
Divergent gene:
Species with an ortholog: AA EC HI PA ST YP
EcoGene link: EG10350
--------------------------------------------------------------------------------
Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 6.92
Model logo: fucK.1.model.LGO.gif
Sequence logo: fucK.1.LGO.gif
Sequence Alignment: fucK.1.ALGN
Solution location in genomic coordinates: 2935404-2935425
Solution sequence with flanking nucleotides: tgatg CCCGGTCGCTCCGGCTACCGGG cctga
Number of overlapping basepairs with reported site: 0
Site type:
--------------------------------------------------------------------------------
Species that contributed to the solution: EC ST
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 6.10
Model logo: fucK.2.model.LGO.gif
Sequence logo: fucK.2.LGO.gif
Sequence Alignment: fucK.2.ALGN
Solution location in genomic coordinates: 2935443-2935458
Solution sequence with flanking nucleotides: agagt GGTTAGCCGGATAAGC a
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: REPt204 Overlap: 11
--------------------------------------------------------------------------------
Species that contributed to the solution: AA EC
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 1.72
Model logo: fucK.3.model.LGO.gif
Sequence logo: fucK.3.LGO.gif
Sequence Alignment: fucK.3.ALGN
Solution location in genomic coordinates: 2935384-2935403
Solution sequence with flanking nucleotides: taata CATTACTCCCTGATGTGATG cccgg
Number of overlapping basepairs with reported site: 0
Site type:
VIEW 7 of 7 COMMENTS
Anyway, thanks.