analogies suck: part1.
picture yourself as a child for a moment.
young. very young. so young you have no experience - no basis for comparison. two years. maybe 3.
you have a dog. you dont know that not everyone has a dog at that age - and thats why you think i its bloody marvelous. well, actually you dont. you just take it for granted....
Read More
picture yourself as a child for a moment.
young. very young. so young you have no experience - no basis for comparison. two years. maybe 3.
you have a dog. you dont know that not everyone has a dog at that age - and thats why you think i its bloody marvelous. well, actually you dont. you just take it for granted....
Read More
VIEW 5 of 5 COMMENTS
"it's too hard"
envision a world where you work at something pretty damned hard. its difficult in fact. not a lot of people do it because it takes a helluva lot of time. ever work 72 hours in a row? three 72 hour shifts with a few hours to 'sleep' and shower inbetween? how about 100 hour weeks back to back to back to back?...
Read More
envision a world where you work at something pretty damned hard. its difficult in fact. not a lot of people do it because it takes a helluva lot of time. ever work 72 hours in a row? three 72 hour shifts with a few hours to 'sleep' and shower inbetween? how about 100 hour weeks back to back to back to back?...
Read More
VIEW 9 of 9 COMMENTS
no:
Nope, I have not a single album. The closest thing I have is the frente remake. NOT THE SAME!
Give me fun stuff!!
Give me fun stuff!!
no:
LOL!! Thanks, oh thou divine sage frontman.
physics.
mmm physics. you know that so much of the world around us just wouldnt work without physics. oh okay, none of it would work. silly me.
for something so important we really seem to take it for granted. in fact, we accept the desecration of the laws of physics on a daily basis. movies. television. video games. news. i know because i've been a...
Read More
mmm physics. you know that so much of the world around us just wouldnt work without physics. oh okay, none of it would work. silly me.
for something so important we really seem to take it for granted. in fact, we accept the desecration of the laws of physics on a daily basis. movies. television. video games. news. i know because i've been a...
Read More
VIEW 10 of 10 COMMENTS
no:
dude, you rock!!!
no:
Got it.
endless summer.
i have a theory that the reason folks in LA are addicted to youth and are getting implants and tucks and nips and so forth isnt entirely because of the film and television industries and the illusion that they portray. rather it has to do with the weather.
think about it for a second. all of socal is blanketed in sunshine throughout the...
Read More
i have a theory that the reason folks in LA are addicted to youth and are getting implants and tucks and nips and so forth isnt entirely because of the film and television industries and the illusion that they portray. rather it has to do with the weather.
think about it for a second. all of socal is blanketed in sunshine throughout the...
Read More
VIEW 5 of 5 COMMENTS
fauxhawk:
I actually think you're right; all three were created by Canadians. But the answer i was looking for was all three are adopted. I know, it's not that funny, but in my own defense, when I was told the joke I was already in a very good mood and having a great time at dinner, so I may have been a bit biased and an easy target for a lame joke.
As for what happened that was so awesome, I'll tell you later. I don't want to post it here, it will make me look like a pretentious prick, which of course I am, but there's no need for others to know that. ;-)
As for what happened that was so awesome, I'll tell you later. I don't want to post it here, it will make me look like a pretentious prick, which of course I am, but there's no need for others to know that. ;-)
zerogirl:
oh man, be glad you are in the land of plastic surgery and never ending summer. it has been so cold and so gray on the east coast for the past two months, it's hard to even want to go outside. i think you're right about the body needing to realize the passage of time, but this winter has been so out of control it's aged me from 24 to 90.
mars.
i was going to go to mars, but analogies are better. so a quick one.
we should go to mars because we shouldnt keep all of our eggs in one basket.
thats it. now back to the good stuff.
analogies are fun part 2.
icing.
imagine you like birthday cake. most people do - but you REALLY like birthday cake. from the first time...
Read More
i was going to go to mars, but analogies are better. so a quick one.
we should go to mars because we shouldnt keep all of our eggs in one basket.
thats it. now back to the good stuff.
analogies are fun part 2.
icing.
imagine you like birthday cake. most people do - but you REALLY like birthday cake. from the first time...
Read More
VIEW 6 of 6 COMMENTS
no:
Too many sad faces. Ack. I will try to make up for it.
I
avocado, weekends, and
ing around!
Do you remember homer's pet Blinky
? Name the animal?
Ooh, did someone say cake?
I
Do you remember homer's pet Blinky
no:
I know, that was an easy one. Um, if 18 is the way it's supposed to be, then I'm generally off the mark by about 18. Oh, you said combined. Well then I guess off by 17
.
Got the message! Thanks for the happy science thoughts. I'm closer to Sacramento than SF. I have this nice picture of me in Hollywood in my pics, but I don't have it on this computer, and so I had to get it from lavalife. Terrible quality! I haven't been there in so long, it took me 4 tries to get my password in right
.
Had your name in my brain as I was falling asleep last night. So tired and a little wacky. Couldn't remember if that was your real name, or if you were a movie character.
Got the message! Thanks for the happy science thoughts. I'm closer to Sacramento than SF. I have this nice picture of me in Hollywood in my pics, but I don't have it on this computer, and so I had to get it from lavalife. Terrible quality! I haven't been there in so long, it took me 4 tries to get my password in right
Had your name in my brain as I was falling asleep last night. So tired and a little wacky. Couldn't remember if that was your real name, or if you were a movie character.
common sense.
tell me this. how do you walk this planet and *not* have any common sense? i'll tell you how:
society coddles us. the folks that would have been eaten by predators or drowned in quicksand after thinking 'hey even though my horse died - i can make it!' are protected by society. the smart folks build walls, lock gates and hunt the monsters...
Read More
tell me this. how do you walk this planet and *not* have any common sense? i'll tell you how:
society coddles us. the folks that would have been eaten by predators or drowned in quicksand after thinking 'hey even though my horse died - i can make it!' are protected by society. the smart folks build walls, lock gates and hunt the monsters...
Read More
VIEW 4 of 4 COMMENTS
mario:
EDIT: Dude, sorry, wrong journal!
My browser is taking me on a ride!!!
[Edited on Jan 15, 2004 11:51PM]
My browser is taking me on a ride!!!
[Edited on Jan 15, 2004 11:51PM]
zerogirl:
you could probably get away with throwing the people without common sense to the wolves if you tell them they'll win a million dollars if they make it through. people seem to be willing to do anything for that. fuck being stranded on an island with no food, being made to eat cow braains and bugs, living without shelter or clothes or a shower for 2 months. i'll keep my sad little paycheck and stay fat, warm, clean, and well groomed, thank you very much.
information.
the hardest thing for all of us to pass on to others is information.
data is easy - well it has *become* easy. what that data means is hard to pass on. very hard.
this is the the trial for everything we do. the massive undertaking to pass on knowledge, experience and basic information to all of the people that need to KNOW is...
Read More
the hardest thing for all of us to pass on to others is information.
data is easy - well it has *become* easy. what that data means is hard to pass on. very hard.
this is the the trial for everything we do. the massive undertaking to pass on knowledge, experience and basic information to all of the people that need to KNOW is...
Read More
no:
My DNA is a some of this and this and a little bit of this (ignore me, please). Mostly I am interested in this, which I designed:
GAATACAAGCTTGGGCTGCAGGTCGACCAAACATTAGATGGGGCGCGTGGTGGCGGCT
GCAGCCGCCACCACGCGCCCCTCGAGCTTAGGGTACCGTTCAGATAGCCACCATGGAA
Paste it here and it makes a fun shape (fold RNA and then choose a structure *jpg*).
And that is the end of this dorkiness. Did I tell you that you rock. Oh yes, I did. Well, keep up all you're good work!
[Edited on Jan 15, 2004 2:13PM]
GAATACAAGCTTGGGCTGCAGGTCGACCAAACATTAGATGGGGCGCGTGGTGGCGGCT
GCAGCCGCCACCACGCGCCCCTCGAGCTTAGGGTACCGTTCAGATAGCCACCATGGAA
Paste it here and it makes a fun shape (fold RNA and then choose a structure *jpg*).
And that is the end of this dorkiness. Did I tell you that you rock. Oh yes, I did. Well, keep up all you're good work!
[Edited on Jan 15, 2004 2:13PM]
no:
On my way out, but
THANK YOU THANK YOU THANK YOU.
THANK YOU THANK YOU THANK YOU.
analogies are fun.
imagine that you like jungle gyms.
most of your life has been spent playing in parks on swings and jungle gyms.
you love it. its fantastic.
as you grow up you are brought to the yearly fair where they have some rides that spin you up in the air..maybe a small rollercoast and a ferris wheel. you love the experience, and want...
Read More
imagine that you like jungle gyms.
most of your life has been spent playing in parks on swings and jungle gyms.
you love it. its fantastic.
as you grow up you are brought to the yearly fair where they have some rides that spin you up in the air..maybe a small rollercoast and a ferris wheel. you love the experience, and want...
Read More
VIEW 8 of 8 COMMENTS
cineman:
Hey man. Sounds like SOMEONE'S been having a good time lately! Congrats on that - I hope it continues to pleasantly surprise you...
and I think you're right re: SGNC, btw.
As for OUR little group, still no word.
EDIT: I just read that you want me to forward everything to Faux, so I will do that now...
[Edited on Jan 14, 2004 9:52PM]
and I think you're right re: SGNC, btw.
As for OUR little group, still no word.
EDIT: I just read that you want me to forward everything to Faux, so I will do that now...
[Edited on Jan 14, 2004 9:52PM]
tuedsay. so tired.
i have been up until 5am the past two nights. yeah - the girl i met online has been a pretty positive experience.
ahem.
i saw big fish last night. it was a great movie, athough i found it a bit slow. still, really fantastic. erm, aside from the spielbergish bookends at the top and bottom that were short but still a...
Read More
i have been up until 5am the past two nights. yeah - the girl i met online has been a pretty positive experience.
ahem.
i saw big fish last night. it was a great movie, athough i found it a bit slow. still, really fantastic. erm, aside from the spielbergish bookends at the top and bottom that were short but still a...
Read More
VIEW 4 of 4 COMMENTS
erin:
Well hi.
I emailed Maxx.
Firelust already said everything i want to say about this movie. It would only be creepy to post it again.
nice meeting you
Firelust already said everything i want to say about this movie. It would only be creepy to post it again.
nice meeting you
fauxhawk:
I thought you guys were hiding dick shots inside the frames.
Or is that just Fight Club fiction
Or is that just Fight Club fiction
the case of the missing sgla boy.
..so part of my goal while at the SG BURLESQUE SHOW at the echo was to get into the secret scociety known as SGLA.
due to stealthy maneuvering [and chatting to the girls selling merchandise - of which i bought a whack of stuff for my friends] i thought i was going to get connected. however, my mission...
Read More
..so part of my goal while at the SG BURLESQUE SHOW at the echo was to get into the secret scociety known as SGLA.
due to stealthy maneuvering [and chatting to the girls selling merchandise - of which i bought a whack of stuff for my friends] i thought i was going to get connected. however, my mission...
Read More
VIEW 4 of 4 COMMENTS
fauxhawk:
I actually had a great time, but then again I didnt have a lot of expectations going in, since I didnt know anybody. Still, I met a lot of people, most of whom I unfortunately dont remember. I was definitely the odd man out. Everybody seemed to know each other, so there wasnt a whole lot of conversation, especially once the bands started to play. I think I lost half my hearing after the second song. It was great to meet you. I figured you might be around at the after-party thats why I wasnt trying to make conversation over 140 decibel of rock n roll.
[Edited on Jan 13, 2004 2:59AM]
[Edited on Jan 13, 2004 2:59AM]
cineman:
I just read your post (after sending 2 emails) and I totally agree with your thoughts. Very much in line with mine...
So, let's you and I and Faux chat and settle on the name for sure and then I'll be happy to work on getting us online, if you want. I have a little time today and am curious about the process anyway.
So, let's you and I and Faux chat and settle on the name for sure and then I'll be happy to work on getting us online, if you want. I have a little time today and am curious about the process anyway.
los angeles girls
dating
hmmm.
so is it weird to have a crush on someone you have never met? no, its not an SG but i met this girl online and we chat and she's cool -but we havent met in RL yet.
weird.
alright forget that introspective moment.. TODAY i received my tickets to the burlesque show. what is going to happen? i have...
Read More
dating
hmmm.
so is it weird to have a crush on someone you have never met? no, its not an SG but i met this girl online and we chat and she's cool -but we havent met in RL yet.
weird.
alright forget that introspective moment.. TODAY i received my tickets to the burlesque show. what is going to happen? i have...
Read More
VIEW 4 of 4 COMMENTS
no:
Nope, not weird at all. Happens to me sometimes. Just a little hard to get off the computer and into real-real life: Phone calls. Planning dates in advance.
Been reading your journal for a couple days. Nice.
Been reading your journal for a couple days. Nice.
cineman:
So, did you make it to SG Burlesque last night? Was it great?
I wish I coulda gone, but I may get to see it in Atlanta and / or Charlotte when I head East for work here soon.
Maybe we should develop a plan for inviting / voting on new members of our Gang. And I'm looking forward to seeing what you come up with, GFX-wise...
See ya!
I wish I coulda gone, but I may get to see it in Atlanta and / or Charlotte when I head East for work here soon.
Maybe we should develop a plan for inviting / voting on new members of our Gang. And I'm looking forward to seeing what you come up with, GFX-wise...
See ya!
trapped in denver.
the airport. delay: unknown
oh my love affair with the airline industry continues.
just a few days ago i had a similar experience - fortunately LAX was able to get me out - rudely, but i got out.
go back and read if you're interested..
it is 2 journal entries back. or 3.
i have had years of flights without problems, but...
Read More
the airport. delay: unknown
oh my love affair with the airline industry continues.
just a few days ago i had a similar experience - fortunately LAX was able to get me out - rudely, but i got out.
go back and read if you're interested..
it is 2 journal entries back. or 3.
i have had years of flights without problems, but...
Read More
VIEW 9 of 9 COMMENTS
cineman:
(I meant "tough-ASS logo" above...but you knew that)
I saw a Matrix Revolutions screening at the DGA, which was a blast. Great picture and sound, virgin print - really helped my opinion of the movie!
Hey, Front: what elements do you think our logo needs? Let's make a list. I'll suggest this, to start:
- a twisted circle of film to form the border
- an overall background of L.A.'s skyline, with an insert of a crazy forced-perspective shot up at the sign with academy marks, as if it's through a Pany viewfinder
- low riders to the East, palm trees to the West
- and a discreet SG logo somewhere, maybe on the Arco Towers
Whattya think?
(copied to Faux's journal also)
I saw a Matrix Revolutions screening at the DGA, which was a blast. Great picture and sound, virgin print - really helped my opinion of the movie!
Hey, Front: what elements do you think our logo needs? Let's make a list. I'll suggest this, to start:
- a twisted circle of film to form the border
- an overall background of L.A.'s skyline, with an insert of a crazy forced-perspective shot up at the sign with academy marks, as if it's through a Pany viewfinder
- low riders to the East, palm trees to the West
- and a discreet SG logo somewhere, maybe on the Arco Towers
Whattya think?
(copied to Faux's journal also)
fauxhawk:
Sounds good. How about Hollywood Hellraisers as a third option? Or is it too showy?
[Edited on Jan 08, 2004 11:42PM]
[Edited on Jan 08, 2004 11:42PM]
JD, 'leaders of men' didn't work.
Girls=girl-vocals music.
It's hard to tell you what I like b'c I don't know what it is....
Um, I'll ttys...maybe tonight if you're up and all. How is LA today? How is your girl?
I've been wearing jelly bracelets for a week.
Ok, bye!!